human mal2 Search Results


mirna 3´utr target expression clone for human mal2  (Genecopoeia)
N/A
GeneCopoeia offers genome-wide human, mouse and rat microRNA (miRNA) 3′ UTR target clones in mammalian expression vectors. miRNA 3′ UTR target clones can be used for miRNA target identification and functional validation of predicted targets,
   Buy from Supplier
human mal2  (OriGene)
91
OriGene human mal2
Figure 2. In vitro validation of the role of IL7 and <t>MAL2</t> in HCC-associated Sorafenib drug resis- tance. (A) IL7 and MAL2 were significantly overexpressed in Sorafenib-resistant mutant PLC/PRF/5 cell pool (Sor-R) compared to the wild-type (WT) parental cell line by qPCR. ****, p < 0.0001; Student
Human Mal2, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+mal2/pm37958451-74-5-8?v=OriGene
Average 91 stars, based on 1 article reviews
human mal2 - by Bioz Stars, 2026-08
91/100 stars
  Buy from Supplier
flag mal2  (OriGene)
90
OriGene flag mal2
Figure 2. In vitro validation of the role of IL7 and <t>MAL2</t> in HCC-associated Sorafenib drug resis- tance. (A) IL7 and MAL2 were significantly overexpressed in Sorafenib-resistant mutant PLC/PRF/5 cell pool (Sor-R) compared to the wild-type (WT) parental cell line by qPCR. ****, p < 0.0001; Student
Flag Mal2, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+mal2/pmc08762588-278-5-11?v=OriGene
Average 90 stars, based on 1 article reviews
flag mal2 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
protein mal2 modulator  (Human Genome Sciences (HGS)
90
Human Genome Sciences (HGS protein mal2 modulator
Figure 2. In vitro validation of the role of IL7 and <t>MAL2</t> in HCC-associated Sorafenib drug resis- tance. (A) IL7 and MAL2 were significantly overexpressed in Sorafenib-resistant mutant PLC/PRF/5 cell pool (Sor-R) compared to the wild-type (WT) parental cell line by qPCR. ****, p < 0.0001; Student
Protein Mal2 Modulator, supplied by Human Genome Sciences (HGS, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+mal2/pm22222285-609-8-1?v=Human+Genome+Sciences+%28HGS
Average 90 stars, based on 1 article reviews
protein mal2 modulator - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
flotillin 1 (flot1) (nm_005803) human tagged orf clone  (OriGene)
91
OriGene flotillin 1 (flot1) (nm_005803) human tagged orf clone
Figure 2. In vitro validation of the role of IL7 and <t>MAL2</t> in HCC-associated Sorafenib drug resis- tance. (A) IL7 and MAL2 were significantly overexpressed in Sorafenib-resistant mutant PLC/PRF/5 cell pool (Sor-R) compared to the wild-type (WT) parental cell line by qPCR. ****, p < 0.0001; Student
Flotillin 1 (Flot1) (Nm 005803) Human Tagged Orf Clone, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+mal2/origene___rc200231?v=OriGene
Average 91 stars, based on 1 article reviews
flotillin 1 (flot1) (nm_005803) human tagged orf clone - by Bioz Stars, 2026-08
91/100 stars
  Buy from Supplier
mal2 human shrna plasmid kit  (OriGene)
N/A
MAL2 Human 4 unique 29mer shRNA constructs in lentiviral GFP vector
   Buy from Supplier
mal2 nm 052886 human tagged orf clone lentiviral particle  (OriGene)
N/A
Lenti ORF particles MAL2 mGFP tagged Human mal T cell differentiation protein 2 gene pseudogene MAL2 200ul 10 7 TU mL
   Buy from Supplier
mal2 (nm_052886) human over-expression lysate  (Boster Bio)
N/A
Transient overexpression lysate of mal, T-cell differentiation protein 2 (MAL2)
   Buy from Supplier
human mal2 knockdown cell line  (AcceGen Biotechnology)
N/A
Human MAL2 knockdown cell line is engineered by our optimized transduction of the specific shRNA with lentivirus. Knockdown levels are determined via qRT-PCR. AcceGen offers generation of stable knockdown (RNAi) cell lines expressing shRNAs targeting
   Buy from Supplier
recombinant human mal2 gst (n-term) protein  (Novus Biologicals)
N/A
Recombinant Human MAL2 GST (N-Term) Protein
   Buy from Supplier
mal2 nm 052886 human tagged orf clone  (OriGene)
N/A
Lenti ORF clone of Human mal T cell differentiation protein 2 gene pseudogene MAL2 mGFP tagged
   Buy from Supplier

Image Search Results


Figure 2. In vitro validation of the role of IL7 and MAL2 in HCC-associated Sorafenib drug resis- tance. (A) IL7 and MAL2 were significantly overexpressed in Sorafenib-resistant mutant PLC/PRF/5 cell pool (Sor-R) compared to the wild-type (WT) parental cell line by qPCR. ****, p < 0.0001; Student

Journal: Cancers

Article Title: Sorafenib Resistance Contributed by IL7 and MAL2 in Hepatocellular Carcinoma Can Be Overcome by Autophagy-Inducing Stapled Peptides.

doi: 10.3390/cancers15215280

Figure Lengend Snippet: Figure 2. In vitro validation of the role of IL7 and MAL2 in HCC-associated Sorafenib drug resis- tance. (A) IL7 and MAL2 were significantly overexpressed in Sorafenib-resistant mutant PLC/PRF/5 cell pool (Sor-R) compared to the wild-type (WT) parental cell line by qPCR. ****, p < 0.0001; Student

Article Snippet: The Lenti ORF clone of human MAL2, Myc-DDK-tagged (OriGene Technologies; RC203862L1) was also used as cDNA template of MAL2 for high fidelity PCR using primer pairs KpnI-Kozak-MAL2 forward CAGGGTACCGCCACCATGTCGGCCGGCGGAGCGTC (5′ to 3′) and EcoRV-MAL2 reverse CGTACGATATCTTACGGTCG CCATCTTCGTA (5′ to 3′), then cloned into a PB transposon expression vector using a similar method for generating pPB/SB-IL7-GFP-Puro.

Techniques: In Vitro, Biomarker Discovery, Mutagenesis

Figure 3. Activation of JAK/STAT and PI3K/AKT signaling pathways by IL7 and MAL2 in HCC- associated Sorafenib resistance. (A) Representative Western blot and relative protein level analyses confirming STAT3 activation in IL7 and MAL2 overexpressing PLC/PRF/5 cells compared with GFP control PLC/PRF/5 cells. *, p < 0.05; **, p < 0.01; two-way ANOVA test. (B) Representative Western blot and relative protein level analyses confirming PI3K/AKT activation in IL7 and MAL2 overexpressing PLC/PRF/5 cells compared with GFP control PLC/PRF/5 cells. *, p < 0.05; **, p < 0.01; two-way ANOVA test. (C) CDKN1A expression was significantly induced in IL7 and/or MAL2 overexpressing PLC/PRF/5 cells under Sorafenib treatment. **, p < 0.01; ***, p < 0.001; Student unpaired t-test. (D) Representative Western blot and relative protein level analyses showing reduced

Journal: Cancers

Article Title: Sorafenib Resistance Contributed by IL7 and MAL2 in Hepatocellular Carcinoma Can Be Overcome by Autophagy-Inducing Stapled Peptides.

doi: 10.3390/cancers15215280

Figure Lengend Snippet: Figure 3. Activation of JAK/STAT and PI3K/AKT signaling pathways by IL7 and MAL2 in HCC- associated Sorafenib resistance. (A) Representative Western blot and relative protein level analyses confirming STAT3 activation in IL7 and MAL2 overexpressing PLC/PRF/5 cells compared with GFP control PLC/PRF/5 cells. *, p < 0.05; **, p < 0.01; two-way ANOVA test. (B) Representative Western blot and relative protein level analyses confirming PI3K/AKT activation in IL7 and MAL2 overexpressing PLC/PRF/5 cells compared with GFP control PLC/PRF/5 cells. *, p < 0.05; **, p < 0.01; two-way ANOVA test. (C) CDKN1A expression was significantly induced in IL7 and/or MAL2 overexpressing PLC/PRF/5 cells under Sorafenib treatment. **, p < 0.01; ***, p < 0.001; Student unpaired t-test. (D) Representative Western blot and relative protein level analyses showing reduced

Article Snippet: The Lenti ORF clone of human MAL2, Myc-DDK-tagged (OriGene Technologies; RC203862L1) was also used as cDNA template of MAL2 for high fidelity PCR using primer pairs KpnI-Kozak-MAL2 forward CAGGGTACCGCCACCATGTCGGCCGGCGGAGCGTC (5′ to 3′) and EcoRV-MAL2 reverse CGTACGATATCTTACGGTCG CCATCTTCGTA (5′ to 3′), then cloned into a PB transposon expression vector using a similar method for generating pPB/SB-IL7-GFP-Puro.

Techniques: Activation Assay, Protein-Protein interactions, Western Blot, Control, Expressing

Figure 4. Autophagy-inducing stapled peptides exerted a synergistic anti-proliferative effect with Sorafenib in resistant HCC cells that co-overexpress both IL7 and MAL2. (A) Autophagy markers

Journal: Cancers

Article Title: Sorafenib Resistance Contributed by IL7 and MAL2 in Hepatocellular Carcinoma Can Be Overcome by Autophagy-Inducing Stapled Peptides.

doi: 10.3390/cancers15215280

Figure Lengend Snippet: Figure 4. Autophagy-inducing stapled peptides exerted a synergistic anti-proliferative effect with Sorafenib in resistant HCC cells that co-overexpress both IL7 and MAL2. (A) Autophagy markers

Article Snippet: The Lenti ORF clone of human MAL2, Myc-DDK-tagged (OriGene Technologies; RC203862L1) was also used as cDNA template of MAL2 for high fidelity PCR using primer pairs KpnI-Kozak-MAL2 forward CAGGGTACCGCCACCATGTCGGCCGGCGGAGCGTC (5′ to 3′) and EcoRV-MAL2 reverse CGTACGATATCTTACGGTCG CCATCTTCGTA (5′ to 3′), then cloned into a PB transposon expression vector using a similar method for generating pPB/SB-IL7-GFP-Puro.

Techniques: